PTC Taster PCR

The polymerase chain reaction, or PCR, is an incredibly useful and powerful technique for copying DNA. In Bio 6B, you'll use PCR in several different experiments:

This page gives the background and protocol for one experiment, while the other pages explain PCR in general and its application to other experiments.

In this experiment, you will use PCR to copy part of your own DNA, perform a restriction digest on the PCR product, and analyze the results on a gel. The goal will be to examine a taste receptor gene from your own genome. You will investigate whether the results of your DNA analysis correspond to your taste sensitivity to bitter substances. Thus, this lab is about a connection between your phenotype (taste sensitivity) and genotype (gel results). This lab is also about how to perform the techniques of PCR (the polymerase chain reaction), restriction digests of DNA, and DNA electrophoresis. Finally, this lab is also about how to look at DNA sequences and understand PCR primer design and restriction sites.

You'll do this experiment over two lab periods:

  • Day 1: Extract DNA and perform PCR
  • Day 2: Perform a restriction digest of the PCR product and analyze the results on a gel

This experiment was adapted for our lab with assistance from Camilo Cordon and Stefan Prajogo, Special Projects students (Spring 2018).

Introduction

Some people find the substances phenylthiocarbamide (PTC) and 6-n-propylthiouracil (PROP) to have an extremely bitter taste, while others don't taste them at all. The difference is due to a polymorphism, or a difference in alleles among different individuals, in the TAS2R38 gene. This gene encodes a taste receptor protein; one common TAS2R38 allele encodes a receptor protein that responds strongly to PTC, while the other common allele encodes a receptor protein that doesn't respond.

In this lab, you'll first test your ability to taste PTC and PROP, then use PCR to copy a fragment of your own TAS2R38 gene. Both alleles (taster and non-taster) produce PCR products of identical size, but the taster allele contains a restriction site for a particular restriction enzyme (SatI), while the nontaster allele doesn't. Thus, it's possible to use PCR and restriction digest to determine a person's genotype at this locus. Since everyone has two copies of the locus, an individual's genotype could be homozygous taster, homozygous non-taster, or heterozygous. In principle, one would expect people with the homozygous genotype to be most sensitive to the bitter taste of PTC, heterozygous individuals to be less sensitive, and homozygous non-tasters to be least sensitive.

How PCR works

See the Polymerase Chain Reaction page for some background on PCR.  For the primer sequences section below, I assume that you've already had an introduction to PCR.

Understanding PCR primer sequences

Here is the complete sequence of the protein-coding region of the TAS2R38 gene:

  1 ATGTTGACTC TAACTCGCAT CCGCACTGTG TCCTATGAAG TCAGGAGTAC ATTTCTGTTC
 61 ATTTCAGTCC TGGAGTTTGC AGTGGGGTTT CTGACCAATG CCTTCGTTTT CTTGGTGAAT
121 TTTTGGGATG TAGTGAAGAG GCAGGCACTG AGCAACAGTG ATTGTGTGCT GCTGTGTCTC
181 AGCATCAGCC GGCTTTTCCT GCATGGACTG CTGTTCCTGA GTGCTATCCA GCTTACCCAC
241 TTCCAGAAGT TGAGTGAACC ACTGAACCAC AGCTACCAAG CCATCATCAT GCTATGGATG
301 ATTGCAAACC AAGCCAACCT CTGGCTTGCT GCCTGCCTCA GCCTGCTTTA CTGCTCCAAG
361 CTCATCCGTT TCTCTCACAC CTTCCTGATC TGCTTGGCAA GCTGGGTCTC CAGGAAGATC
421 TCCCAGATGC TCCTGGGTAT TATTCTTTGC TCCTGCATCT GCACTGTCCT CTGTGTTTGG
481 TGCTTTTTTA GCAGACCTCA CTTCACAGTC ACAACTGTGC TATTCATGAA TAACAATACA
541 AGGCTCAACT GGCAGAATAA AGATCTCAAT TTATTTTATT CCTTTCTCTT CTGCTATCTG
601 TGGTCTGTGC CTCCTTTCCT ATTGTTTCTG GTTTCTTCTG GGATGCTGAC TGTCTCCCTG
661 GGAAGGCACA TGAGGACAAT GAAGGTCTAT ACCAGAAACT CTCGTGACCC CAGCCTGGAG
721 GCCCACATTA AAGCCCTCAA GTCTCTTGTC TCCTTTTTCT GCTTCTTTGT GATATCATCC
781 TGTGTTGCCT TCATCTCTGT GCCCCTACTG ATTCTGTGGC GCGACAAAAT AGGGGTGATG
841 GTTTGTGTTG GGATAATGGC AGCTTGTCCC TCTGGGCATG CAGCCATCCT GATCTCAGGC
901 AATGCCAAGT TGAGGAGAGC TGTGATGACC ATTCTGCTCT GGGCTCAGAG CAGCCTGAAG
961 GTAAGAGCCG ACCACAAGGC AGATTCCCGG ACACTGTGCT GA

For this experiment, youl'll attempt to amplify the region highlighted in yellow. The primer sequences for this experiment are described on the PCR Primer Design page. The PTC nontaster allele sequence is shown here; the taster allele has three single-nucleotide differences.

Here is the sequence of the entire 303-bp (base pairs, or nucleotide pairs) PCR product shown above:

      AACT GGCAGAATAA AGATCTCAAT TTATTTTATT CCTTTCTCTT CTGCTATCTG TGGTCTGTGC CTCCTTTCCT ATTGTTTCTG GTTTCTTCTG GGATGCTGAC TGTCTCCCTG GGAAGGCACA TGAGGACAAT GAAGGTCTAT ACCAGAAACT CTCGTGACCC CAGCCTGGAG GCCCACATTA AAGCCCTCAA GTCTCTTGTC TCCTTTTTCT GCTTCTTTGT GATATCATCC TGTGTTGCCT TCATCTCTGT GCCCCTACTG ATTCTGTGGC GCGACAAAAT AGGGGTGATG GTTTGTGTT

The primer binding regions are highlighted in orange, with a SatI restriction site (described below) in pink. The primer sequences used in this experiment are: 

Forward Primer 5′ AACTGGCAGAATAAAGATCTCAATTTAT 3′

Reverse Primer 5′ AACACAAACCATCACCCCTATTTT 3′.

For a review of the primer sequences, see PCR Primer Design.

A sequence polymorphism

The primers shown above should work for everyone's DNA, since these primers match conserved regions of the genome, in which almost everyone has the same nucleotide sequence. If we perform PCR with those primers, we should get PCR products of 303 bp from everyone. However, there is a sequence polymorphism within the PCR product. A polymorphism is a nucleotide sequence that varies from one individual to another. In this case, there are two common alleles, or versions of the sequence. Although the initial PCR products should be the same length from everyone, one allele contains a restriction site that isn't present in the other allele. One allele can be cut by the restriction enzyme SatI, while the other allele can't be cut with this enzyme.

TAS

The SatI restriction site

Restriction enzymes are defined as enzymes that cut DNA molecules at specific short nucleotide sequences. The restriction enzyme SatI cuts DNA at the restriction site GCNGC (N refers to any nucleotide). Here is the sequence of the entire 303-bp PCR product, but this time it's the taster allele:

      AACT GGCAGAATAA AGATCTCAAT TTATTTTATT CCTTTCTCTT CTGCTATCTG TGGTCTGTGC CTCCTTTCCT ATTGTTTCTG GTTTCTTCTG GGATGCTGAC TGTCTCCCTG GGAAGGCACA TGAGGACAAT GAAGGTCTAT ACCAGAAACT CTCGTGACCC CAGCCTGGAG GCCCACATTA AAGCCCTCAA GTCTCTTGTC TCCTTTTTCT GCTTCTTTGT GATATCATCC TGTGCTGCCT TCATCTCTGT GCCCCTACTG ATTCTGTGGC GCGACAAAAT AGGGGTGATG GTTTGTGTT

The SatI restriction site is highlighted in pink. If  you cut this PCR product with SatI, you will get a fragment of 239 bp and a fragment of 64 bp. Compare this to the nontaster version shown above. In that allele, the pink-highlighted sequence is GTTGC, so that PCR product won't get cut by SatI. You'd only see the 303-bp band on your gel.

Here is a gel from our lab:

 Camilo05012018a

People who are homozygous for the nontaster allele would be expected to have only the 303 bp band, while people who are heterozygous have the 303 bp nontaster band along with the 238 bp and 64 bp bands from the taster PCR product. It's also possible to be homozygous for the  taster allele (only the 238 and 64 bp bands, no 303), but that genotype isn't shown on this gel.

The primer dimer is a small, fuzzy band produced by the primers being copied without binding to the template DNA; it's a common PCR artifact, but isn't particularly relevant to this experiment.

Taste test

We have two substances for you to taste: phenylthiocarbamide (PTC) and 6-n-propylthiouracil (PROP). They come infused in paper for the taste test. You should test yourself with both.

Procedure

Place a PTC or PROP strip on your tongue and leave it for 5 seconds. Take it away and wait 10 seconds, then rate how bitter the strip tastes. Use a 1-5 scale, with 1 being not at all bitter and 5 being extremely bitter. Wait a few minutes and then test the other type of strip. Record the results for everyone in your group for both PROP and PTC.

Record your results in the class spreadsheet

Go to this Google sheet: PTC PCR Experiment Spring 2018. Record your gel and taste test results.

DNA template preparation

You’ll need to obtain some of your own DNA for this lab. Luckily, PCR is very efficient and you don’t need much DNA. You can get what you need by swishing a few detached cells from the lining of your cheek. DNA doesn’t need to be very pure for PCR, but you need to get rid of two things: enzymes that might damage DNA, and cations like Mg2+ that would interfere with the PCR enzyme. You can achieve these two goals by simply boiling your cells with a product called Chelex. Boiling kills the enzymes and lyses the cells. Chelex is a solid resin that is negatively charged, so it binds cations. Chelex isn’t water soluble, so it will be a powder in the bottom of your micro tube, pulling away harmful ions and leaving you with ready-to-use DNA. You’ll be using a version of Chelex called Insta-Gene Matrix, made by the Bio-Rad Corporation.

Materials for preparing DNA sample

  • Pipetmen and tips
  • Beaker for waste tips
  • Styrofoam cup with ice

For each person in your lab group, obtain the following:

  • 1 small paper cup with a small mouthful of saline solution
  • 1 large (1.5 ml) micro tube for each sample
  • 1 500 µl microcentrifuge tube containing Instagene® Chelex resin (Note: the chelex is a solid, mixed in with the buffer in the tube. Look at your chelex tubes and make sure each one contains a substantial pellet of chelex. It's difficult to pipet the suspended chelex, so sometimes some of the tubes come up short.)

Procedure for DNA sample preparation

Note: this procedure is written as if you’re going to have only one tube. However, you should have a tube for each person; you can incubate them all together.

  1. Put approximately 10 ml of sterile saline into the cup. Pour the saline into your mouth and swish it vigorously in your cheeks for 30–60 seconds. Vigorous swishing frees loose epithelial cells from the inside of your mouth, and the salt solution prevents the cells from being osmotically lysed at this point. Expel the saline back into the cup.
  2. Fill the 1.5 ml micro tube with 1.5 ml of the saline rinse suspension. Centrifuge at high speed for 2 minutes. (If you have an odd number of tubes and need an extra one to balance the centrifuge, just fill another tube with your saline rinse.) You should observe a match-head size white pellet at the bottom of the tube with your exfoliated cheek epithelial cells. If the pellet isn't white, it isn't your epithelial cells; it's something else that was in your mouth. Your pellet should be clearly visible and at least a couple of millimeters across, but bigger isn’t necessarily better. If you don’t have enough cells, carefully decant or pipet off the supernatant, add another 1.5 ml of oral rinse suspension, and centrifuge again. Repeat until a sufficient pellet is observed.
  3. After pelleting your cells, pipet off most of the supernatant, taking care not to lose the pellet. It's ok if a small amount of liquid remains with the pellet.
  4. Label 1 tube of Chelex (Instagene®) for your DNA sample.
  5. Using the P-200, pipet up and down the liquid in with your oral pellet to evenly resuspend your cells. Transfer the entire volume to your tube with the Chelex resin. Cap and vortex thoroughly.
  6. Incubate at 100°C for 10 minutes. This should lyse the cells and denature proteins.
  7. Vortex the tube again and then spin for 5 minutes with the centrifuge on low speed.
  8. Be sure that all the Chelex resin has pelleted to the bottom of the tube. You can use the liquid directly in the PCR. When you transfer some of it to your PCR tube, be sure not to transfer any of the Chelex-containing pellet; it will interfere with PCR. If you disturb the Chelex pellet, spin the tube again before using it.

Your DNA is now ready to use in PCR. Keep it on ice until you start the PCR. After you are done with today's PCR, store your DNA sample in the freezer in case we want to use it again.

PCR

Calculations for PCR

Before you can set up your PCR reactions, you will need to prepare a master mix (also called a cocktail) that contains all the PCR ingredients except the template DNA, which will be different for each reaction. Figuring out the amounts to out into the cocktail will require a little calculation. Refer to the PCR Setup page for instructions on how to do this, and the PCR page for background.

Use this table for preparing the master mix for this experiment:

 Ingredient Initial Concentration Volume For 1 Reaction Final Concentration Volume for (N+1) Reactions
Water  NA          μl  NA  
 Buffer  5x        μl  1x  
 MgCl2 25 mM        μl 1.5mM  
  dNTPs 10 mM        μl   200 μM  
 Foward Primer 10 μM         μl 1 μM  
 Reverse Primer 10 μM       μl  1 μM  
 Taq Polymerase  5 Units/μl      μl 1.25 Units   
DNA Template unknown 10 μl  NA Don't add to master mix!
Total:   50 μl   (N+1) x 40 μl = 

First, calculate the amounts for all the ingredients in one PCR reaction.

Next, use those calculated numbers to calculate the amounts for a master mix containing everything  but the template. Make enough master mix for the number of PCRs you're doing, plus one extra.

Prepare the master mix

Now you’re ready to start pipetting. Obtain the following materials:

  • Ice bucket with ice
  • Pipetmen, tips, and a beaker for waste tips
  • 1 500-µl micro tube for the cocktail.
  • 1 strip of PCR tubes (Special tubes for PCR, not the usual micro tubes. They come in strips of 8 connected tubes.)
  • Sterile water
  • 5x GoTaq reaction buffer
  • 25 mM MgCl2
  • 10 mM Nucleotide mix (labeled nuc)
  • Primers PTC Forward and PTC Reverse, each 10 μM
  • GoTaq polymerase (As usual, you don't get the enzyme until you have added all the other ingredients to your cocktail tube. The polymerase should be in a separate ice bucket from the other ingredients, and we'll pass around the ice bucket with the polymerase in it.)
  • Your DNA templates that you prepared earlier.
  • Positive control templates

Keep all the cocktail ingredients and your cocktail tube on ice. Before you pipet anything, make sure all the ingredients are thawed and mixed. (Enzymes don't need to be thawed; they don't freeze at normal freezer temperature, because they contain glycerol.)

  1. Label your cocktail tube. Use a small (500 μl) micro tube.
  2. Prepare your cocktail on ice, according to the table you filled in above. Be careful to pipet each ingredient into the bottom of the tube, and mix carefully with the pipet tip.
  3. Pipet 40 µl master mix into each of the reaction tubes. After adding master mix to each reaction tube, you should have about 40 µl left. Don’t worry if it isn’t exact, but if you’re way off, you may have made a mistake. (How could you measure the leftovers in your cocktail tube?)
  4. Label your PCR tubes (write on the sides, because the top may get smeared in the PCR machine; don’t use tape, because it might interfere with the tubes’ fit in the PCR machine). Since the tubes are in a strip, you can write your group initials once and a number on each tube. Make sure you record which template goes in each tube.
  5. Don't add template to the reaction tubes until the instructor tells you! You should add it right before we start the thermal cycler (PCR machine), and the whole class should be ready to start at the same time. Keep your master mix on ice until you start PCR.

Add the templates

When the time comes, add 10 µl of the proper template to each reaction tube, following the order below. Keep the tubes on ice while you do this.

Tube # / Template

  1. Negative control (10 µl sterile water instead of DNA template)
  2. Positive control: homozygous nontaster
  3. Positive control: heterozygous taster/nontaster
  4. Your own DNA template
  5. Your own DNA template
  6. Your own DNA template
  7. Your own DNA template
  8. Don't use tube 8.

Set up a total of 7 PCR reactions. (Later, when you run your gel, you'll load 7 samples and one molecular weight marker to fill the 8 lanes on your gel). If you have five people in your group, skip one of the positive controls.

Once everyone has added their templates, put the reaction tubes in the PCR machine and start it. The machine will take more than an hour to go through all the cycles. After the PCR is complete, the DNA is fairly stable; it can sit at room temperature for a couple of days. Later, you’ll perform a restriction digest on your PCR products and then use electrophoresis to look at your results.

Program the thermal cycler (PCR machine)

This step should actually be done before you start preparing your master mix, but I"m putting it at the end, because it's probably already set up. The machine needs to be programmed to take your samples through the proper temperature steps. Each set of denature, anneal, and extend steps is called a cycle. The program for the PTC PCR reactions should be:

40 cycles of:

  1. 95° C for 45 seconds
  2. 55° C for 45 seconds
  3. 72° C for 90 seconds

1 Cycle of 

  1. 72° C for 10 minutes (This long final extension ensures that all PCR products are synthesized completely.
  2. 4° C until collected (The tubes can sit at this temperature overnight if necessary.)

(The PCR machine should already have this program saved, under the name TAS PCR.)

Before you leave

  • If the PCR machine is still running, leave your PCR tubes in the machine.
  • Throw out the leftover cocktail along with your waste tips (biohazard).
  • Save all your DNA templates in the freezer in case the PCR doesn’t work.

Restriction digest

You'll need to digest your PCR products with the restriction enzyme SatI so you can tell the difference between the "taster" and "nontaster" alleles. Both alleles should give an initial PCR product of 303 bp, but the taster allele contains a SatI restriction site, so it should get cut into fragments of 264 and 39 bp. The nontaster allele should remain uncut at 303 bp.

Restriction digests

Prepare your restriction digests as follows:

Component Volume
PCR reaction 13.0 µl
10x Anza red buffer (or Buffer G) 1.5 µl
SatI restriction enzyme (5 Units/µl; labeled Anza SatI 108) 0.5 µl
Total volume 15.0 µl

Do this for all your student PCR samples and your positive controls. For the negative control, set up a tube but don't add the enzyme. Don't get the enzyme until everything else is in your restriction digest tubes. As soon as you are ready and get the enzyme in its ice bucket, pipet the enzyme into your tubes and pass on the ice bucket with the enzyme to another group.

If possible, incubate your restriction digests for 1 hour at 37° C. If you're running out of time, leave at least 40 minutes to load and run your gel at the end of lab, and incubate your digests as long as you can.

Run the gel

We could run the gel the same day as the restriction digest, or we might do it the next lab period. Check the schedule.

Prepare a gel

Prepare a DNA gel with 2% agarose.

Load and run the gel

For each digested sample, run the entire 15 µl volume of the digested PCR product on the gel. (Don't use the original uncut PCR products, which are in a strip of 8 PCR tubes; use the digests, which you probably set up in individual 0.5 ml micro tubes.) Mix each sample with 2 µl DNA gel loading buffer (also called sample buffer). Since you're loading the entire volume of the tube, you can mix the sample buffer with the sample in the tube instead of on parafilm, but make sure it's fully mixed before you load it on the gel.

Load your gel like this:

  1. Negative control (10 µl sterile water instead of DNA template)
  2. Positive control: homozygous nontaster
  3. Positive control: heterozygous taster/nontaster
  4. Your own DNA template
  5. Your own DNA template
  6. Your own DNA template
  7. Your own DNA template
  8. Molecular weight marker (5 µl of EZ Load Precision Molecular Mass Ruler or 10 µl of 100 bp ladder).

Run your gel at 80 volts until the lowest blue dye reaches about halfway down the gel.

Record your results in the class spreadsheet

Go to this Google sheet: PTC PCR Experiment Spring 2018. Record your gel and taste test results. The main concept of this lab is that there should be a correlation between the taste test results and the gel results. Is it true?

Review

Terms & concepts

  • Allele
  • Chelex
  • Conserved regions
  • Polymorphism
  • Substitution (this lab) vs. insertion (PV92)
  • Restriction enzye and site

The PTC taster/TAS2R38 PCR experiment

  1. How does the gel result in this experiment relate to a person's ability to taste PTC or PROP?
  2. Why do we need to do a restriction digest in this lab, but not in the PV92 lab? How does the restriction digest help you differentiate the two alleles?
  3. What results do you expect to see on the gel? Why would different individuals give different results? Why would some individuals show one band, while some show two? Diagram the possible results.
  4. Explain the possible results in terms of: locus and allele; genotype; homozygous and heterozygous.
  5. How does this experiment take advantage of conserved regions and polymorphic regions in the genome?
  6. Both the PTC PCR experiment and the PV92 experiment use PCR to examine polymorphisms among students in the class. Explain how the polymorphisms are different, and how we use different approaches to identify each person's genotype in these two experiments. (Hint: These polymorphisms both arose as a result of mutations. What kind of mutations? Your answer should include these words: allele, substitution, insertion, transposon).
  7. Compare and contrast the PV92 and TAS2R38 (or PTC taster) loci in terms of protein coding.
  8. What controls should you have in this experiment? (There should be controls for both PCR and the restriction digest.)

References

Tasting Phenylthiocarbamide (PTC): A New Integrative Genetics Lab with an Old Flavor by Merritt et al. in American Biology Teacher/BioOne. The procedures we're using are based on this excellent, detailed article.

PTC and PROP tasting

PTC tasting: The myth. John McDonald argues that PTC tasting is not binary; different people can taste PTC at different concentrations. Also, while the correlation between TAS2R8 allele and PTC tasting is fairly strong, this locus is not the only thing controlling PTC tasting. This is to be expected, since biological traits generally aren't controlled only by a single locus. Many biology teachers have sought examples of human traits that, like those in Mendel's pea plants, are controlled by a single locus with one dominant and one recessive allele. This generally isn't realistic, and it's not the case for TAS2R38. However, that may make this locus a good example of a typical genetically controlled trait, rather than a "pure Mendel" simple example.

TAS2R38

TAS2R38 on Wikipedia.

TAS2R38 gene, Genetics Home Reference, NIH

Homo sapiens candidate taste receptor TAS2R38 gene, complete cds. This is the GenBank entry containing the complete coding sequence of the gene — in other words, the sequence of nucleotides that codes for the protein, without any promoter or other noncoding sequences.

The genetics of phenylthiocarbamide perception. Detailed analysis.

Global diversity in the TAS2R38 bitter taste receptor: revisiting a classic evolutionary PROPosal. Risso et al., 2016.

Restriction enzymes

Restriction Enzymes from PDB-101. Simple description and molecular diagrams.

DNA Restriction from DNA Learning Center. Brief animated description of restriction, sticky ends, and ligation.

A- A A+